| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.170078 |
| Chromosome: | chromosome 12 |
| Location: | 1095750 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g490750 | (1 of 239) IPR016024 - Armadillo-type fold | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCATGCTGCGCCGCTGCAGCTGCACTGGCC |
| Internal bar code: | GAATGGGTCAATGGCCAGAGCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 908 |
| LEAP-Seq percent confirming: | 64.4508 |
| LEAP-Seq n confirming: | 1590 |
| LEAP-Seq n nonconfirming: | 877 |
| LEAP-Seq n unique pos: | 15 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACCGCTACTCCCATTGACAC |
| Suggested primer 2: | GCTGTCTCGGAGTGTCCTTC |