| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.170088 |
| Chromosome: | chromosome 15 |
| Location: | 1156619 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre15.g641100 | (1 of 66) 2.7.12.1 - Dual-specificity kinase | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TATAACTTTTGTCGCGGACATATTTATGCA |
| Internal bar code: | CCGTCATCGCTATAGGGAGGGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 680 |
| LEAP-Seq percent confirming: | 98.1053 |
| LEAP-Seq n confirming: | 466 |
| LEAP-Seq n nonconfirming: | 9 |
| LEAP-Seq n unique pos: | 25 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTCACGGATCCGACACTTCT |
| Suggested primer 2: | ACCTGCCTAAACCCTGTCCT |