| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.170164 |
| Chromosome: | chromosome 4 |
| Location: | 2087712 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre04.g219200 | CPL19 | (1 of 1) IPR007751//IPR015422//IPR029058 - Domain of unknown function DUF676, lipase-like // Pyridoxal phosphate-dependent transferase, major region, subdomain 2 // Alpha/Beta hydrolase fold; possible serine esterase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACGTTATCACCGTGAGCGTTGTTCGATGAG |
| Internal bar code: | TGTGACCGCGCCGGATCGAATA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 417 |
| LEAP-Seq percent confirming: | 98.9762 |
| LEAP-Seq n confirming: | 7444 |
| LEAP-Seq n nonconfirming: | 77 |
| LEAP-Seq n unique pos: | 45 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CACGATCTGTATGGGGTGTG |
| Suggested primer 2: | TATAGTGTGGGTGGGTGGGT |