| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.170183 |
| Chromosome: | chromosome 17 |
| Location: | 666859 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g700650 | GFY2 | (1 of 5) PTHR30178 - INNER MEMBRANE PROTEIN YAAH; Putative acetate transporter | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTGCCTTAATCCTGTCCCATCGCACACACC |
| Internal bar code: | GTAGTTGGCATCTCAATATACT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 925 |
| LEAP-Seq percent confirming: | 99.8536 |
| LEAP-Seq n confirming: | 2046 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 22 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TAACTCATGTGCAAGCTGCC |
| Suggested primer 2: | ATAAGGCTGAGCTGGGGATT |