| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.170248 |
| Chromosome: | chromosome 5 |
| Location: | 3024010 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre05.g238500 | (1 of 4) K06941 - 23S rRNA (adenine2503-C2)-methyltransferase [EC:2.1.1.192] (rlmN) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGGCTGAAGTTGTTGCTATCCCCGTTGCAG |
| Internal bar code: | GATGATGAGGCGGTTGGGGATG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 241 |
| LEAP-Seq percent confirming: | 96.4181 |
| LEAP-Seq n confirming: | 1319 |
| LEAP-Seq n nonconfirming: | 49 |
| LEAP-Seq n unique pos: | 10 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACAGAGACCAAACCGTGTCC |
| Suggested primer 2: | GTGCAGCTTCAACCTCATCA |