| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.170255 |
| Chromosome: | chromosome 7 |
| Location: | 1132066 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g320350 | CDJ5 | (1 of 3) PF00226//PF13370 - DnaJ domain (DnaJ) // 4Fe-4S single cluster domain of Ferredoxin I (Fer4_13); Chloroplast DnaJ-like protein 5 | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCTGATAACGATGTGCAAAACACTGACACT |
| Internal bar code: | TCTATAGCACCTTGCTGTTCCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 86 |
| LEAP-Seq percent confirming: | 99.9155 |
| LEAP-Seq n confirming: | 1183 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACTCATTGCGCCTAAGCATT |
| Suggested primer 2: | GATAGCGTGCGAAGCACATA |