| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.170289 |
| Chromosome: | chromosome 9 |
| Location: | 22743 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g386119 | (1 of 2) PF13383 - Methyltransferase domain (Methyltransf_22) | 3'UTR_intron|outside_mRNA | |
| Cre09.g386125 | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCTTACAGCTCTGCAACTTTGAGCATGGGG |
| Internal bar code: | AGTCTTGGCATCGCGGCGAGGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 409 |
| LEAP-Seq percent confirming: | 88.758 |
| LEAP-Seq n confirming: | 6782 |
| LEAP-Seq n nonconfirming: | 859 |
| LEAP-Seq n unique pos: | 37 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGACGAGCACTATCACTCCG |
| Suggested primer 2: | ATGCCGTTAAAATGGACGAG |