| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.170360 |
| Chromosome: | chromosome 6 |
| Location: | 7105895 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g297082 | (1 of 2) 2.7.11.1//4.6.1.1 - Non-specific serine/threonine protein kinase / Threonine-specific protein kinase // Adenylate cyclase / ATP pyrophosphate-lyase | intron|outside_mRNA |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGTGATTATTACGGTGATCAAGCGTGGTTA |
| Internal bar code: | CGAGTCTCCTCTATGTTTTTAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 562 |
| LEAP-Seq percent confirming: | 99.5078 |
| LEAP-Seq n confirming: | 6267 |
| LEAP-Seq n nonconfirming: | 31 |
| LEAP-Seq n unique pos: | 13 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAGGATGTGTTCCAGGAGGT |
| Suggested primer 2: | GTATGTTGTGCTGACGTGGG |