| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.170385 |
| Chromosome: | chromosome 9 |
| Location: | 810492 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g401950 | (1 of 8) 2.7.11.12 - cGMP-dependent protein kinase / PKG II | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGCGCCTGCCCCTGCTCCCAATACTGGGAC |
| Internal bar code: | CAGACAAGGGGCCCGCGTCTTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 340 |
| LEAP-Seq percent confirming: | 86.9248 |
| LEAP-Seq n confirming: | 10012 |
| LEAP-Seq n nonconfirming: | 1506 |
| LEAP-Seq n unique pos: | 30 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGAGGTGTGGTATCATGCGT |
| Suggested primer 2: | CTAGGGGGCATGTATGCTGT |