| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.170459 |
| Chromosome: | chromosome 10 |
| Location: | 2210881 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g433900 | (1 of 2) K10592 - E3 ubiquitin-protein ligase HUWE1 (HUWE1, MULE, ARF-BP1) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGGCTCCACCATGACGCTGCCGCCGCCCAG |
| Internal bar code: | TTAGAGGTGTTTTATTCAACT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 499 |
| LEAP-Seq percent confirming: | 99.512 |
| LEAP-Seq n confirming: | 2447 |
| LEAP-Seq n nonconfirming: | 12 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CATATTGTGCGGCCCTTACT |
| Suggested primer 2: | TGAACTGACTGGCTGGAGTG |