| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.170484 |
| Chromosome: | chromosome 16 |
| Location: | 1229647 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g650950 | (1 of 1) PF01931 - Protein of unknown function DUF84 (NTPase_I-T) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTTTTGCACAGCCCCAGTCCACTGACGTCC |
| Internal bar code: | AGGGTTAGGTACCGACTCTGGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 746 |
| LEAP-Seq percent confirming: | 98.0528 |
| LEAP-Seq n confirming: | 2115 |
| LEAP-Seq n nonconfirming: | 42 |
| LEAP-Seq n unique pos: | 14 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGTTTGTCCAGACCTTGCAT |
| Suggested primer 2: | GTGCGGACAACAACAACAAC |