| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.170493 |
| Chromosome: | chromosome 16 |
| Location: | 903459 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g648300 | PHT6,PHT4-6,PHT4F | Sodium-dependent phosphate transporter, major facilitator superfamily; (1 of 3) PTHR11662:SF243 - ANION TRANSPORTER 6, CHLOROPLASTIC-RELATED | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGCGAACATTGGGAGTGCATTGAGGCCGCC |
| Internal bar code: | GCTTGCTCCGGTAGTCGCCGCT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 662 |
| LEAP-Seq percent confirming: | 99.8723 |
| LEAP-Seq n confirming: | 782 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 13 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCGTCCAGGACCTAGGAATG |
| Suggested primer 2: | TACGAGGTGACGGTTCATCA |