| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.170522 |
| Chromosome: | chromosome 9 |
| Location: | 7019865 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g411100 | RPS10 | Cytosolic 80S ribosomal protein S10; (1 of 1) K02947 - small subunit ribosomal protein S10e (RP-S10e, RPS10) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCCGCCCGAGCCGCCGAACTGGGGCTGGTA |
| Internal bar code: | GGAGGCCTAGTAGGAAGCAGCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 668 |
| LEAP-Seq percent confirming: | 99.6627 |
| LEAP-Seq n confirming: | 1182 |
| LEAP-Seq n nonconfirming: | 4 |
| LEAP-Seq n unique pos: | 13 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTGGAAAGATGTTTGAGGGG |
| Suggested primer 2: | GACCAACAAGGGCATTGACT |