| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.170625 |
| Chromosome: | chromosome 3 |
| Location: | 3736664 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g169700 | TMG11 | tRNA (guanosine-2'-O)-methyltransferase; (1 of 1) PTHR12029:SF45 - RRNA METHYLASE-LIKE PROTEIN | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACATGCCGGTGCAATGGTTACAGGCTGTTG |
| Internal bar code: | ACGCTTAGTCGAGACTTTGCCA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 816 |
| LEAP-Seq percent confirming: | 98.2948 |
| LEAP-Seq n confirming: | 5649 |
| LEAP-Seq n nonconfirming: | 98 |
| LEAP-Seq n unique pos: | 33 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TAAGGGTGATAGTGGGGCTG |
| Suggested primer 2: | ACAACACGACAGACCACCAA |