| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.170721 |
| Chromosome: | chromosome 14 |
| Location: | 2602312 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre14.g625850 | MMP32 | Matrix metalloproteinase; (1 of 1) IPR003980//IPR008752 - Histamine H3 receptor // Peptidase M11, gametolysin | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGTTGCGTGTTGCGTGGCCTGAAACCTGAT |
| Internal bar code: | CGGTTCCAGGGCTCGCTCCCGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 149 |
| LEAP-Seq percent confirming: | 96.7487 |
| LEAP-Seq n confirming: | 2083 |
| LEAP-Seq n nonconfirming: | 70 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACGTACCCGGTGAGAATCAG |
| Suggested primer 2: | ACACACACACACACACCACG |