| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.170771 |
| Chromosome: | chromosome 6 |
| Location: | 3873087 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g278177 | DNL6,LIG6 | (1 of 1) PTHR10459:SF44 - ANKYRIN REPEAT-CONTAINING PROTEIN; DNA ligase 6 | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTTGCAAGTTCGGGCATTGGGGCGTTGCCA |
| Internal bar code: | CTAGTTGGCTAGCTCAGTCGTT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 805 |
| LEAP-Seq percent confirming: | 99.7314 |
| LEAP-Seq n confirming: | 2599 |
| LEAP-Seq n nonconfirming: | 7 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGCAAAGACTCGTGCCATCT |
| Suggested primer 2: | CCCCAAGCCCTACTACAACA |