| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.170840 |
| Chromosome: | chromosome 16 |
| Location: | 4655894 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g687450 | CPLD54 | (1 of 1) PTHR16254//PTHR16254:SF6 - POTASSIUM/PROTON ANTIPORTER-RELATED // K(+) EFFLUX ANTIPORTER 3, CHLOROPLASTIC; potassium ion transmembrane transporter | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTTTCCCCTTGAGAGGGAGATCCAAAACCG |
| Internal bar code: | GCTATGTGGCAGGACGAGGGCT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 608 |
| LEAP-Seq percent confirming: | 99.2196 |
| LEAP-Seq n confirming: | 2670 |
| LEAP-Seq n nonconfirming: | 21 |
| LEAP-Seq n unique pos: | 18 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCCTTCAGCTCTCTGGACAT |
| Suggested primer 2: | CAACATCCACCAGAAACACG |