| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.170920 |
| Chromosome: | chromosome 9 |
| Location: | 656655 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g403200 | FAP198 | Flagellar Associated Protein 198; (1 of 1) PTHR21281//PTHR21281:SF0 - UNCHARACTERIZED // CYTOCHROME B5 DOMAIN-CONTAINING PROTEIN 1 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATGTTCCGTGCGTACGCCCAACCAACTGCA |
| Internal bar code: | GCTCATCCTGTTAGAAGGACCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 352 |
| LEAP-Seq percent confirming: | 97.4277 |
| LEAP-Seq n confirming: | 606 |
| LEAP-Seq n nonconfirming: | 16 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAGCACGGGGATGAAGTAGT |
| Suggested primer 2: | TCTGGTTCTTCACACCTCCC |