| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.171061 |
| Chromosome: | chromosome 13 |
| Location: | 1227429 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g570300 | UBC24 | (1 of 1) K13960 - ubiquitin-conjugating enzyme E2 T (UBE2T, HSPC150); E2 Ubiquitin conjugating enzyme | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CATGTTTATGCAGTGTGAGCACAGCGGACA |
| Internal bar code: | GGGCATAAAAACGAGGACTCGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 391 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 323 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTCTTCCTGATGGGAGCTTG |
| Suggested primer 2: | CCCCACTTGAGCTTCATCAT |