Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.171116 |
Chromosome: | chromosome 16 |
Location: | 961597 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre16.g648750 | (1 of 1) PF10373 - Est1 DNA/RNA binding domain (EST1_DNA_bind) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTGACGACGTGTGTCCATGTCAAATGTTGT |
Internal bar code: | GGACTTCGTTCTAAACCAGGCC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 152 |
LEAP-Seq percent confirming: | 99.455 |
LEAP-Seq n confirming: | 6569 |
LEAP-Seq n nonconfirming: | 36 |
LEAP-Seq n unique pos: | 14 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GCAAGCAATGGGTCAAAAAT |
Suggested primer 2: | AGCAGGTGTGTAGGGAATGG |