| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.171147 |
| Chromosome: | chromosome 2 |
| Location: | 3327716 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g095090 | (1 of 25) IPR013216//IPR029063 - Methyltransferase type 11 // S-adenosyl-L-methionine-dependent methyltransferase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTTATCTGCTTCCGCATTCCATAGCGCCAT |
| Internal bar code: | GACGAGTTAGACGGCCGGACCC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1030 |
| LEAP-Seq percent confirming: | 98.8814 |
| LEAP-Seq n confirming: | 2210 |
| LEAP-Seq n nonconfirming: | 25 |
| LEAP-Seq n unique pos: | 17 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGCTTGCGAGTGAATGAAAC |
| Suggested primer 2: | ACGCTGGCTTGCTTTGTATT |