| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.171244 |
| Chromosome: | chromosome 7 |
| Location: | 3622029 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g336950 | PHO2,PHOA2,PHOA | Starch phosphorylase 2, PhoA; (1 of 2) 2.4.1.1 - Glycogen phosphorylase / Polyphosphorylase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGTGAAAAGAATCTTGGGCCGCGAGCCCCA |
| Internal bar code: | CATTCAGTGGCCGCTGGTGCAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 759 |
| LEAP-Seq percent confirming: | 96.8481 |
| LEAP-Seq n confirming: | 338 |
| LEAP-Seq n nonconfirming: | 11 |
| LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GAATGGAAGAAACGGGTGAA |
| Suggested primer 2: | TGCCTGGCATAGTGTAGCAG |