Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.171335 |
Chromosome: | chromosome 14 |
Location: | 3704598 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre14.g631900 | (1 of 1) K14648 - poly(U)-specific endoribonuclease (ENDOU, PP11); Similar to Putative Serine Protease | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATCGGGAACGCGGTTTACCCATGCAAGAAT |
Internal bar code: | CAGGTGAGTCCACGTGGAGCAT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 790 |
LEAP-Seq percent confirming: | 99.7876 |
LEAP-Seq n confirming: | 7047 |
LEAP-Seq n nonconfirming: | 15 |
LEAP-Seq n unique pos: | 32 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GCGATTCATTATTTTGCCGT |
Suggested primer 2: | CTTGTAGAGGAGTGAGGCGG |