Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.171362 |
Chromosome: | chromosome 10 |
Location: | 4375261 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre10.g451400 | NIT4,CNX1B,CNX1E | (1 of 1) 2.10.1.1//2.7.7.75 - Molybdopterin molybdotransferase // Molybdopterin adenylyltransferase; Molybdenum cofactor biosynthesis protein | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGTCTTTTGGCGGCAGCACCCACGCACAAT |
Internal bar code: | GTGTTCCACATTTTCAGTTAA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 369 |
LEAP-Seq percent confirming: | 99.0453 |
LEAP-Seq n confirming: | 2075 |
LEAP-Seq n nonconfirming: | 20 |
LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CTTCCCGGTTTTCTGTGTGT |
Suggested primer 2: | TTCTGAGGATGACAAAGGGG |