Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.171399 |
Chromosome: | chromosome 9 |
Location: | 672087 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre09.g403050 | LSF2,DSP6 | Laforin glucan phosphatase (SEX4)-like 2; (1 of 1) PTHR10159//PTHR10159:SF326 - DUAL SPECIFICITY PROTEIN PHOSPHATASE // LAFORIN | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GAGGGAACATGGGCACAGGTTCGTGGAATG |
Internal bar code: | CTTGTCTCCAAGATGCGAATAG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 862 |
LEAP-Seq percent confirming: | 94.2956 |
LEAP-Seq n confirming: | 2992 |
LEAP-Seq n nonconfirming: | 181 |
LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ACACACCACCAGCACCAGTA |
Suggested primer 2: | TGGCATTGAAGCAACAGAAG |