| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.171402 |
| Chromosome: | chromosome 16 |
| Location: | 802187 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g647500 | NRX4 | Peptidase M16 family protein; (1 of 1) PTHR11851//PTHR11851:SF153 - METALLOPROTEASE // INSULINASE (PEPTIDASE FAMILY M16) PROTEIN | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTCCGGCATGCGCCGCACGTGCACCCATAC |
| Internal bar code: | GCGCAACCAGGCAGAGTATTCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 654 |
| LEAP-Seq percent confirming: | 91.1681 |
| LEAP-Seq n confirming: | 2240 |
| LEAP-Seq n nonconfirming: | 217 |
| LEAP-Seq n unique pos: | 24 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCTCCTCGATATGCCAACAT |
| Suggested primer 2: | GCACTTTCTCTTCCACCTGC |