Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.171408 |
Chromosome: | chromosome 9 |
Location: | 3161265 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre09.g387134 | (1 of 3) PF04379 - Protein of unknown function (DUF525) (DUF525) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCAAGCAACACGGAAACGGAACTCAGAAAG |
Internal bar code: | AGTGTTGTTGTCCTGTGCCCCC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 509 |
LEAP-Seq percent confirming: | 97.5422 |
LEAP-Seq n confirming: | 635 |
LEAP-Seq n nonconfirming: | 16 |
LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AGGTACCGTATCCAAGCACG |
Suggested primer 2: | ATCCGTGAGAGTGACTGCCT |