| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.171410 |
| Chromosome: | chromosome 1 |
| Location: | 4594616 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g031500 | (1 of 1) 1.10.3.2//1.10.3.3 - Laccase / Urishiol oxidase // L-ascorbate oxidase / Ascorbase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CAGAACCGTCATGGCGCATGCCAGGTGGTA |
| Internal bar code: | GCGAGAGTTTCATGGATGCGGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1082 |
| LEAP-Seq percent confirming: | 74.8106 |
| LEAP-Seq n confirming: | 1185 |
| LEAP-Seq n nonconfirming: | 399 |
| LEAP-Seq n unique pos: | 17 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGACGCACTTACACACACGC |
| Suggested primer 2: | CTGGGAAAGGGTGTGTGAGT |