Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.171425 |
Chromosome: | chromosome 14 |
Location: | 2825098 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre14.g627433 | (1 of 1) PF04142 - Nucleotide-sugar transporter (Nuc_sug_transp) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TATTAAGAAGTGAAGGTGTAGGCAGGTACA |
Internal bar code: | GGGTAGAGCGGGAGGTGGTACG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 164 |
LEAP-Seq percent confirming: | 96.1276 |
LEAP-Seq n confirming: | 422 |
LEAP-Seq n nonconfirming: | 17 |
LEAP-Seq n unique pos: | 12 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GACGACCCGCCAATTAACTA |
Suggested primer 2: | COULD_NOT_FIND_PRIMER |