| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.171446 |
| Chromosome: | chromosome 12 |
| Location: | 224806 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g485050 | CAH6 | Carbonic Anhydrase 6; (1 of 3) PTHR11002//PTHR11002:SF17 - CARBONIC ANHYDRASE // SUBFAMILY NOT NAMED | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACGCAACTGCCCGACAATCCGGCGACAGGC |
| Internal bar code: | CTGGGGCCATCATGGGGTTACT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 701 |
| LEAP-Seq percent confirming: | 99.6032 |
| LEAP-Seq n confirming: | 2259 |
| LEAP-Seq n nonconfirming: | 9 |
| LEAP-Seq n unique pos: | 15 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGCACTCAAACTCTCCAACG |
| Suggested primer 2: | CCGAGTAGCAGTAAGCAGGG |