Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.171446 |
Chromosome: | chromosome 12 |
Location: | 6503759 |
Confidence (%): | 58 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g538600 | (1 of 4) PF00041 - Fibronectin type III domain (fn3) | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TAATCACACGGCCAGCTGCTTGTCACAGTA |
Internal bar code: | GAGTCCTTGCGTGGCGCGGACA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 495 |
LEAP-Seq percent confirming: | 94.4362 |
LEAP-Seq n confirming: | 3819 |
LEAP-Seq n nonconfirming: | 225 |
LEAP-Seq n unique pos: | 24 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GCAGGTGGCGGTACAGTAAT |
Suggested primer 2: | TACTGGGCGGTACCTTGTTC |