| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.171455 |
| Chromosome: | chromosome 12 |
| Location: | 5415164 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g530050 | IPP7 | similar to inositol polyphosphate phosphatase; (1 of 2) 3.1.3.36 - Phosphoinositide 5-phosphatase / Type II inositol-1,4,5-trisphosphate 5-phosphatase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGCTGCGCCCTCCTCCACGTTGCCTGACAA |
| Internal bar code: | CTGTTGACGCACACCCTTTTCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 134 |
| LEAP-Seq percent confirming: | 62.4277 |
| LEAP-Seq n confirming: | 108 |
| LEAP-Seq n nonconfirming: | 65 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACTGGTGCTAGAGGTGCAGG |
| Suggested primer 2: | GGGTTTTGTCTGGTTGCTGT |