Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.171504 |
Chromosome: | chromosome 1 |
Location: | 2542342 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre01.g014650 | PHX2,P4H5,PFH5 | Prolyl 4-hydroxylase 5; (1 of 14) K00472 - prolyl 4-hydroxylase (E1.14.11.2) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACACAGGTTCTCCGCTACGGGCCCACCAAC |
Internal bar code: | TGAGTGGGCTATACGGCAAGAC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1011 |
LEAP-Seq percent confirming: | 99.3173 |
LEAP-Seq n confirming: | 4946 |
LEAP-Seq n nonconfirming: | 34 |
LEAP-Seq n unique pos: | 28 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GGGGACTTGGAAGTTTGTCA |
Suggested primer 2: | TCGGCATCATACTGCTTCTG |