| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.171518 |
| Chromosome: | chromosome 6 |
| Location: | 5160966 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g281450 | SRR22 | Scavenger receptor cysteine rich (SRCR) protein; (1 of 1) 1.4.3.13//2.7.11.1 - Protein-lysine 6-oxidase / Lysyl oxidase // Non-specific serine/threonine protein kinase / Threonine-specific protein kinase | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGCCTGTGAGCTTTGCATTGTCATGCGGAA |
| Internal bar code: | ATTTCCCCTGGACTTCGTTTCA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 329 |
| LEAP-Seq percent confirming: | 98.8131 |
| LEAP-Seq n confirming: | 333 |
| LEAP-Seq n nonconfirming: | 4 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACGAGTATGAACAGGGACGG |
| Suggested primer 2: | CACATGCATAACCTATGGCG |