Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.171536 |
Chromosome: | chromosome 1 |
Location: | 2797608 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre01.g016570 | (1 of 1) IPR000104//IPR000719//IPR001245//IPR002290//IPR011009//IPR016024//IPR020635 - Antifreeze protein, type I // Protein kinase domain // Serine-threonine/tyrosine-protein kinase catalytic domain // Serine/threonine/dual specificity protein kinase, catalytic domain // Protein kinase-like domain // Armadillo-type fold // Tyrosine-protein kinase, catalytic domain | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCGAACCCAGGCACATAAACGTGCTACACA |
Internal bar code: | GCATTAGGCGTCCTGCAATCCC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 359 |
LEAP-Seq percent confirming: | 98.6564 |
LEAP-Seq n confirming: | 1028 |
LEAP-Seq n nonconfirming: | 14 |
LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GACCGTACTGTCCGACCTGT |
Suggested primer 2: | ATGCATGTAACCCCTTCCAG |