| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.171943 |
| Chromosome: | chromosome 12 |
| Location: | 6485923 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g538450 | EPT1 | CDP-Ethanolamine:DAG Ethanolamine phosphotransferase; (1 of 1) 2.7.8.1 - Ethanolaminephosphotransferase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCCCCACTGCCGTGTTGGCTTTCCCCTTCC |
| Internal bar code: | TTATCTGTTGTCTTTGGACTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 886 |
| LEAP-Seq percent confirming: | 94.1176 |
| LEAP-Seq n confirming: | 80 |
| LEAP-Seq n nonconfirming: | 5 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AAGCGATTTCTCGCTGATGT |
| Suggested primer 2: | TTCGGATGAGAGCTCGTTTT |