| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.171997 |
| Chromosome: | chromosome 9 |
| Location: | 2196985 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g393050 | PRM6,PRM, PRMT6 | (1 of 1) PTHR11006//PTHR11006:SF4 - PROTEIN ARGININE N-METHYLTRANSFERASE // PROTEIN ARGININE N-METHYLTRANSFERASE 7; Protein-/Histone-arginine N-methyltransferase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTGGAGTAAAATACGCACACACACACACAC |
| Internal bar code: | AGCCGCGAGCAGAAGTGCCAAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 866 |
| LEAP-Seq percent confirming: | 41.5304 |
| LEAP-Seq n confirming: | 4369 |
| LEAP-Seq n nonconfirming: | 6151 |
| LEAP-Seq n unique pos: | 32 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GACCACGCTTTGGTTTCATT |
| Suggested primer 2: | GTCTGTCTCGTTGTGTGCGT |