| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.172040 |
| Chromosome: | chromosome 3 |
| Location: | 5364366 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g184350 | (1 of 1) K13094 - RNA-binding protein 5/10 (RBM5_10) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATATTGCGAAGTCGGCAGGGCACCGGATGT |
| Internal bar code: | GCGTTCTTTCGCGGAGAGGCGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 827 |
| LEAP-Seq percent confirming: | 98.3593 |
| LEAP-Seq n confirming: | 15347 |
| LEAP-Seq n nonconfirming: | 256 |
| LEAP-Seq n unique pos: | 141 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCACTCGCATACCTGCTTTG |
| Suggested primer 2: | TACAAAAACGCAGAAACCCC |