Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.172066 |
Chromosome: | chromosome 2 |
Location: | 5811867 |
Confidence (%): | 58 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre02.g110950 | FAP133,DIC5,D1bIC2WD34 | WD-Repeat Intermediate Chain of Dynein 1b; (1 of 2) PTHR12442:SF26 - WD REPEAT-CONTAINING PROTEIN 34 | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTTGGCGCGGGGGTGGCGGAGCGGGTGATG |
Internal bar code: | GGGGTCGGCTGCGGGTTGGTGC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 437 |
LEAP-Seq percent confirming: | 99.3217 |
LEAP-Seq n confirming: | 1025 |
LEAP-Seq n nonconfirming: | 7 |
LEAP-Seq n unique pos: | 18 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TGCTTACATCGTTGCTGAGG |
Suggested primer 2: | GCGTGGAAGAGAAAGAATCG |