Insertion junction: LMJ.RY0402.172071_2

Overview

Insertion cassette:CIB1
Side of cassette:3'
Strand:-
Strain:LMJ.RY0402.172071
Chromosome:chromosome_3
Location:5003055
Confidence (%):73
Locus disrupted Locus common name Defline Orientation Feature
Cre03.g180450 FAP215,FPN1 5\'-nucleotidase and Flagellar Associated Protein sense 3'UTR

Insertion site details

Flanking sequence (orientation from cassette outwards):GAGGACAGGGGCGTGCACAGCACCCCTGGC
Internal bar code:ACTGGGAACGGAGTTGCGTTAC

Confirmation - LEAP-Seq

LEAP-Seq distance:96
LEAP-Seq percent confirming:100.0
LEAP-Seq n confirming:71
LEAP-Seq n nonconfirming:0
LEAP-Seq n unique pos:2

Suggested primers for confirmation by PCR

Suggested primer 1:GACAAGCACACATGGTCCAC
Suggested primer 2:CAGAAGCACAACGGCAGATA