| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.172071 |
| Chromosome: | chromosome_3 |
| Location: | 5003055 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Orientation | Feature |
|---|---|---|---|---|
| Cre03.g180450 | FAP215,FPN1 | 5\'-nucleotidase and Flagellar Associated Protein | sense | 3'UTR |
Insertion site details | |
| Flanking sequence (orientation from cassette outwards): | GAGGACAGGGGCGTGCACAGCACCCCTGGC |
| Internal bar code: | ACTGGGAACGGAGTTGCGTTAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 96 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 71 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GACAAGCACACATGGTCCAC |
| Suggested primer 2: | CAGAAGCACAACGGCAGATA |