| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.172093 |
| Chromosome: | chromosome 6 |
| Location: | 8445604 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g307300 | ANT2 | ADP/ATP carrier protein, mitochondrial; (1 of 3) K05863 - solute carrier family 25 (mitochondrial adenine nucleotide translocator), member 4/5/6/31 (SLC25A4S, ANT) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGAGTGGGTCACATGAAACACGGACTAAGT |
| Internal bar code: | CAAGGACCGACGTGGAAAAGAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 168 |
| LEAP-Seq percent confirming: | 57.688 |
| LEAP-Seq n confirming: | 514 |
| LEAP-Seq n nonconfirming: | 377 |
| LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAGCATGTCGTAGCCGTAGA |
| Suggested primer 2: | AGCCTGTACTTCGGGCTGTA |