| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.172142 |
| Chromosome: | chromosome 3 |
| Location: | 6411229 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g194400 | EIF3I | Eukaryotic translation initiation factor 3, subunit I; (1 of 1) K03246 - translation initiation factor 3 subunit I (EIF3I) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTCATGCGCTGAGGATGCGCTGATGCAGTA |
| Internal bar code: | TAACGACGGGCTGCACTTCACA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 916 |
| LEAP-Seq percent confirming: | 99.4949 |
| LEAP-Seq n confirming: | 1182 |
| LEAP-Seq n nonconfirming: | 6 |
| LEAP-Seq n unique pos: | 12 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGCTGGTTAAAATGCCAGAA |
| Suggested primer 2: | TAGGTTAGGCCGTGGATGAC |