| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.172190 |
| Chromosome: | chromosome 3 |
| Location: | 6470543 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g194900 | CYA4 | Lipocalin-like adenylate cyclase; (1 of 3) PTHR11017//PTHR11017:SF145//PTHR12203//PTHR12203:SF13 - LEUCINE-RICH REPEAT-CONTAINING PROTEIN // SUBFAMILY NOT NAMED // KDEL LYS-ASP-GLU-LEU CONTAINING - RELATED // F10K1.7 PROTEIN | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGCTGGTATTTACGGCCCCCTCTCTTTATG |
| Internal bar code: | GGCGCGTCACGGCCCTACGGTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 473 |
| LEAP-Seq percent confirming: | 90.4762 |
| LEAP-Seq n confirming: | 912 |
| LEAP-Seq n nonconfirming: | 96 |
| LEAP-Seq n unique pos: | 11 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCCCCGTCCTCCATACTATT |
| Suggested primer 2: | GTTGCGTCGTTAGGGAAGAG |