| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.172206 |
| Chromosome: | chromosome 13 |
| Location: | 225898 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g563600 | UBQ7 | Ubiquitin-fusion protein; (1 of 5) IPR000626//IPR019956//IPR029071 - Ubiquitin domain // Ubiquitin // Ubiquitin-related domain | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTCTTAGTTGACCGTACCTGACCTCTGGTT |
| Internal bar code: | GGCGCTCAGGCAAGACCACGCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 552 |
| LEAP-Seq percent confirming: | 74.8517 |
| LEAP-Seq n confirming: | 1262 |
| LEAP-Seq n nonconfirming: | 424 |
| LEAP-Seq n unique pos: | 17 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACTAGGCATTTGATGGGCAG |
| Suggested primer 2: | TTTATTTTGTGCCCAAAGGC |