| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.172244 |
| Chromosome: | chromosome 3 |
| Location: | 9187533 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g212865 | (1 of 3) IPR002638 - Quinolinate phosphoribosyl transferase, C-terminal | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCTGCCGACTGTACGACTGACGTGCCCACC |
| Internal bar code: | ACAGTGCTGTCAATGCAGCGGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 736 |
| LEAP-Seq percent confirming: | 99.609 |
| LEAP-Seq n confirming: | 12229 |
| LEAP-Seq n nonconfirming: | 48 |
| LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTAACGGTGCTCAGGAGGAG |
| Suggested primer 2: | TCATGGTTGCTGTCTCGAAG |