Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.172428 |
Chromosome: | chromosome 12 |
Location: | 4854480 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g525050 | SMC6A | (1 of 2) PTHR19306//PTHR19306:SF6 - STRUCTURAL MAINTENANCE OF CHROMOSOMES 5,6 SMC5, SMC6 // PROTEIN C23H4.6, ISOFORM A-RELATED; Structural Maintenance of Chromosomes protein | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTCTAAGGAGTGGCAGGGGCAGGCGGGCCT |
Internal bar code: | CTCGAAAAGGCCGCGCGACCTC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1092 |
LEAP-Seq percent confirming: | 99.814 |
LEAP-Seq n confirming: | 3220 |
LEAP-Seq n nonconfirming: | 6 |
LEAP-Seq n unique pos: | 27 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AACACTCTTCCGTCCACCAC |
Suggested primer 2: | TAGGAGCTGAACTTGGCGTT |