| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.172634 |
| Chromosome: | chromosome 8 |
| Location: | 1121699 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre08.g362600 | BLA1 | (1 of 2) PF00144 - Beta-lactamase (Beta-lactamase); beta-lactamase family protein | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCTGGCGCCCTGACCCGCCTTGTGGGATTT |
| Internal bar code: | ACCGTCTGCAAGGCACAGCCAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 346 |
| LEAP-Seq percent confirming: | 99.3896 |
| LEAP-Seq n confirming: | 977 |
| LEAP-Seq n nonconfirming: | 6 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCCTGTGCTTTGTTGCTTTG |
| Suggested primer 2: | GACGATCACATACCACGCAC |