Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.172683 |
Chromosome: | chromosome 1 |
Location: | 4029601 |
Confidence (%): | 58 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre01.g026250 | AGA1 | Alpha-galactosidase; (1 of 1) 3.2.1.22 - Alpha-galactosidase / Melibiase | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AAAGCAGTCACACGACCGGCTATAAAACAT |
Internal bar code: | CATGCGTGCGCGCCCACTTGC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 477 |
LEAP-Seq percent confirming: | 99.8652 |
LEAP-Seq n confirming: | 2222 |
LEAP-Seq n nonconfirming: | 3 |
LEAP-Seq n unique pos: | 17 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CACGCCTCCATACAACACAC |
Suggested primer 2: | GTGCGTCGAGTCATGACAGT |