Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.172757 |
Chromosome: | chromosome 3 |
Location: | 4343851 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre03.g175050 | TRP13 | Transient receptor potential ion channel protein; (1 of 6) PTHR10117 - TRANSIENT RECEPTOR POTENTIAL CHANNEL | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCTAATTCCTACGGCTTGTTTTTCCCGCCA |
Internal bar code: | AGGCAGGTCGACAGTGTACCTC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 551 |
LEAP-Seq percent confirming: | 98.6755 |
LEAP-Seq n confirming: | 149 |
LEAP-Seq n nonconfirming: | 2 |
LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CCATGACACCACGCAGATAC |
Suggested primer 2: | ACATGCACACATGCACACAC |