Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.172780 |
Chromosome: | chromosome 2 |
Location: | 2675161 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre02.g093300 | (1 of 1) K12864 - beta-catenin-like protein 1 (CTNNBL1) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGTGGTTGTGTAGGGTGGCGGTGCTGACAT |
Internal bar code: | ATGTCAGAGTAAACGCCAGTCT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1112 |
LEAP-Seq percent confirming: | 99.6858 |
LEAP-Seq n confirming: | 4125 |
LEAP-Seq n nonconfirming: | 13 |
LEAP-Seq n unique pos: | 31 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TGTTAGAGGGTGAAGACGGG |
Suggested primer 2: | TCATTTAACGCAGACGCAAG |